FAQ

Toehold switch is a RNA sequence with hairpin. Only corresponding RNA sequence can release the RBS in hairpin and let downstream signal protein express.
Uppercase/ lowercase DNA/RNA, numbers and spaces are accepted. Do not input line breaks and characters other than A/T/C/G/U.
Manipulate the sequence to uppercase DNA form;
Screen for suitable trigger sequence;
Generate corresponding switch sequence;
Calculate RBS-linker energy for each pair of sequence;
Add sticky end for corresponding RE site, if any;
Rank switches accordring to machine learning;
Generate csv file;
The switches with Minimum Free Energies (MFE) of less than -10 kcal/mol for its RBS-linker region are preferred.

BBA_J23119 TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGC
BBA_J23100 TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC
BBA_J23101 TTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGC
BBA_J23102 TTGACAGCTAGCTCAGTCCTAGGTACTGTGCTAGC
BBA_J23103 CTGATAGCTAGCTCAGTCCTAGGGATTATGCTAGC
BBA_J23104 TTGACAGCTAGCTCAGTCCTAGGTATTGTGCTAGC
BBA_J23105 TTTACGGCTAGCTCAGTCCTAGGTACTATGCTAGC
BBA_J23106 TTTACGGCTAGCTCAGTCCTAGGTATAGTGCTAGC
BBA_J23107 TTTACGGCTAGCTCAGCCCTAGGTATTATGCTAGC
BBA_J23108 CTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGC
BBA_J23109 TTTACAGCTAGCTCAGTCCTAGGGACTGTGCTAGC
BBA_J23110 TTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGC
BBA_J23111 TTGACGGCTAGCTCAGTCCTAGGTATAGTGCTAGC
BBA_J23112 CTGATAGCTAGCTCAGTCCTAGGGATTATGCTAGC
BBA_J23113 CTGATGGCTAGCTCAGTCCTAGGGATTATGCTAGC
BBA_J23114 TTTATGGCTAGCTCAGTCCTAGGTACAATGCTAGC
BBA_J23115 TTTATAGCTAGCTCAGCCCTTGGTACAATGCTAGC
BBA_J23116 TTGACAGCTAGCTCAGTCCTAGGGACTATGCTAGC
BBA_J23117 TTGACAGCTAGCTCAGTCCTAGGGATTGTGCTAGC
BBA_J23118 TTGACGGCTAGCTCAGTCCTAGGTATTGTGCTAGC
http://parts.igem.org/Ribosome_Binding_Sites/Catalog Constitutive prokaryotic RBS
  1. Anderson RBS library (12bp):
    J61100 AAAGAGGGGACAA
    J61101 AAAGACAGGACCC
    J61102 AAAGATCCGATGT
    J61103 AAAGATTAGACAA
    J61104 AAAGAAGGGACAG
    J61105 AAAGACATGACGT
    J61106 AAAGATAGGAGAC
    J61107 AAAGAAGAGACTC
    J61108 AAAGACGAGATAT
    J61109 AAAGACTGGAGAC
    J61110 AAAGAGGCGAATT
    J61111 AAAGAGGCGATAC
    J61112 AAAGAGGTGACAT
    J61113 AAAGAGTGGAAAA
    J61114 AAAGATGAGAAGA
    J61115 AAAGAAGGGATAC
    J61116 AAAGACATGAGGC
    J61117 AAAGACATGAGTT
    J61118 AAAGAGACGAATC
    J61119 AAAGATTTGATAT
    J61120 AAAGACGCGAGAA
    J61121 AAAGAGACGAGTC
    J61122 AAAGAGAGGAGCC
    J61123 AAAGAGATGACTA
    J61124 AAAGAGCCGACAT
    J61125 AAAGAGCCGAGTT
    J61126 AAAGAGGTGACTC
    J61127 AAAGAGTGGAACT
    J61128 AAAGATAGGACTC
    J61129 AAAGATTGGACGT
    J61130 AAAGAAACGACAT
    J61131 AAAGAACCGAATT
    J61132 AAAGACAGGATTA
    J61133 AAAGACCCGAGAC
    J61134 AAAGACCGGAAAT
    J61135 AAAGACCGGAGAC
    J61136 AAAGAGCTGAGCA
    J61137 AAAGAGTAGATCA
    J61138 AAAGATATGAATA
    J61139 AAAGATTAGAGTC
  2. Community RBS Collection (15bp)
    BBa_B0029 TTCACACAGGAAACC
    BBa_B0030 ATTAAAGAGGAGAAA
    BBa_B0031 TCACACAGGAAACC
    BBa_B0032 TCACACAGGAAAG
    BBa_B0033 TCACACAGGAC
    BBa_B0034 AAAGAGGAGAAA
    BBa_B0035 ATTAAAGAGGAGAA
    BBa_B0064 AAAGAGGGGAAA
RFC10: EcoRI, NotI, XbaI, SpeI, PstI
RFC12: EcoRI, NotI, SpeI, NheI, PstI
RFC21: EcoRI, BglII, BamHI, Xhoi
RFC23: same as RFC10
RFC25: EcoRI, NotI, XbaI, SpeI, PstI, NgoMIV, AgeI

EcoRI site: GAATTC
XbaI site: TCTAGA
NgoMIV site: GCCGGC
AgeI site: ACCGGT
SpeI site:
PstI site: CTGCAG
NotI site: GCGGCCGC
NheI site, GCTAGC
BglII site: AGATCT
BamHI site: GGATCC
XhoI site: CTCGAG

Back to top